two-component sensor kinase, phosphorylates [[protein|Spo0F]], part of the [SW|phosphorelay], senses changes in respiratory activity

two-component sensor kinase, phosphorylates [[protein|Spo0F]], part of the [SW|phosphorelay]

BSU31450

BSU_31450

BSU31450

BSU_31450

autophosphorylation, phosphorylation of [[protein|Spo0F]]

mainly active in the older, inner regions of a colony (with [[protein|KinA]]) [Pubmed|21097618]

sensing potassium level in the medium during initiation of [SW|sliding] [Pubmed|26152584]

autophosphorylation, phosphorylation of [[protein|Spo0F]]

mainly active in the older, inner regions of a colony (with [[protein|KinA]]) [Pubmed|21097618]

senses potassium level in the medium during initiation of [SW|sliding] [Pubmed|26152584]

senses changes in respiratory activity [pubmed|23599347]

senses nutrient starvation in MM medium to initiate sporulation [pubmed|29314743]

ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)

six transmembrane segments, C-terminal histidine phosphotransferase domain

selectivity filter sequence of potassium channels that is required for [SW|sliding] but not for [SW|sporulation] [Pubmed|26152584]

six transmembrane segments, C-terminal histidine phosphotransferase domain

selectivity filter sequence of potassium channels that is required for [SW|sliding] but not for [SW|sporulation] [Pubmed|26152584]

[SW|Histidine kinase domain] (aa 218-426) (according to UniProt)

[PDB|3D36] (from G. stearothermophilus, complex with [[protein|Sda]])

[PDB|3D36] (from G. stearothermophilus, complex with [[protein|Sda]]) [pubmed|19101565]

JH19980 (''kinB''::''tet'') [Pubmed|9334321]

JH19980 (''kinB''::''tet'') [Pubmed|9334321]

BKE31450 (Δ[[gene|kinB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC, downstream forward: _UP4_TAGCAAATCGATTGGAACTT

BKK31450 (Δ[[gene|kinB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC, downstream forward: _UP4_TAGCAAATCGATTGGAACTT

26152584, 8576055, 16166384, 9299348, 8497199, 10094672, 9426145, 11069677, 12618455, 11902725, 12618455, 7592498, 21097618, 19101565, 23378509, 23599347, 26152584, 28723971

26152584, 8576055, 16166384, 9299348, 8497199, 10094672, 9426145, 11069677, 12618455, 11902725, 12618455, 7592498, 21097618, 19101565, 23378509, 23599347, 26152584, 28723971, 29314743, 29321771, 19101565

[[this]]